Viva Biotech Included as Constituent Stock of Hang Seng Composite Index and Other 6 Indexes, Becoming an Eligible Stock of Shenzhen-Hong Kong Stock Connect

HONG KONG, Feb 24, 2020 – (ACN Newswire) – After the market closed on 21 February 2020, Hang Seng Indexes Company Limited announced the results of its review of the Hang Seng Family of Indexes for the quarter ended 31 December 2019. Viva Biotech Holdings ("Viva Biotech" or the "Company"; stock code: 1873.HK), the world leading operator of a structure-based drug discovery (SBDD) platform, was included as a constituent stock of seven indexes, namely Hang Seng Composite Index, Hang Seng Healthcare Index, Hang Seng Stock Connect Hong Kong Index, Hang Seng Stock Connect Hong Kong MidCap & SmallCap Index, Hang Seng Stock Connect Hong Kong SmallCap Index, Hang Seng SCHK HK Companies Index and Hang Seng SCHK ex-AH Companies Index. The constituent changes will be made to the Hang Seng Family of Indexes with effect from 9 March 2020. Included in the Hang Seng Composite Index also means that Viva Biotech will be selected as an eligible stock of the China-Hong Kong Stock Connect in accordance with the selection requirements of the Shenzhen-Hong Kong Stock Connect.

The biopharmaceutical sector in recent years has been gaining extensive attention from domestic and foreign investors. The inclusion of Viva Biotech as a constituent stock of Hang Seng Composite Index, Hang Seng Stock Connect Hong Kong Index and Hang Seng Healthcare Index and other important indicatable indexes in the Hong Kong capital market was another milestone after being included in the Hang Seng Hong Kong-Listed Biotech Index in December 2019. It reflects the full recognition of Viva Biotech's overall performance in the capital market and its great influence in the healthcare industry, which will further help to enhance the awareness of the Company among domestic and foreign investors.

Hang Seng Indexes Company Limited conducts quarterly review of the constituents in the Hang Seng Family of Indexes. A total of 22 stocks will be added and 26 will be removed in this quarterly review of Hang Seng Composite Index, and the total number of constituents will decrease from 480 to 476.

About Viva Biotech Holdings
Viva Biotech's mission is to become a cradle for innovative biotechnology companies around the world. Viva Biotech has developed a scalable business model combing the conventional cash-for-service (CFS) model and its unique equity-for-service (EFS) model. Under the CFS model, the Group provides structure-based drug discovery services to its biotechnology and pharmaceutical customers worldwide for their pre-clinical stage innovative drug development, covering the full spectrum of the customers' needs for early stage drug discovery, including target protein expression and structure research, hit screening, lead optimization and drug candidate determination. Viva Biotech also provides drug discovery and incubation services to biotechnology start-up companies with high potential under its EFS model. As of June 30, 2019, Viva Biotech had provided drug discovery services to 388 biotechnology and pharmaceutical customers worldwide, worked on over 1,000 independent drug targets, delivered over 11,000 independent protein structures, and incubated a total of 37 early stage R&D projects.


Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

NanoViricides has filed Quarterly Report for period ending December 31, 2019; Sufficient Cash, HerpeCide(TM) Drug Candidate IND Application Development in Progress

SHELTON, CT / ACCESSWIRE, Feb 24, 2020 – (ACN Newswire) – NanoViricides, Inc. (NYSE American: NNVC), a global leader in the development of highly effective antiviral therapies based on a novel nanomedicines platform, has filed its quarterly report for its second quarter of financial year 2020 in a timely manner with the Securities and Exchange Commission. This press release should be read in conjunction with the Form 10-Q filed on February 14, 2020. The submission can be downloaded from the SEC website at: https://www.sec.gov/Archives/edgar/data/1379006/000110465920021930/tm205411-1_10q.htm.

The Company reported that it had approximately $1.0 Million (M) of current assets (cash, cash equivalents, and prepaid expenses), and current cash liabilities of approximately $1.4M excluding a recent mortgage (described below), as of December 31, 2019, the end of the reporting period. The net cash used in operating activities during the six months period was approximately $2.56M. The Company's expenditures were in line with budget estimates. Shareholder equity stood at approximately $7.72M for the quarter (unaudited figures), primarily due to the asset value of its cGMP-capable manufacturing facility, R&D labs, and equipment, that it owns fully except for a $2 Million secured debt provision. The Company had no revenues. The Company has no long term debt.

The Company drew down $1.1M from a $2M non-convertible loan commitment secured by a mortgage on the Company's facility provided by the Company's founder and President, Anil R. Diwan, PhD. The mortgage is payable in full on March 31, 2021, with no payments due until then. Interest is payable only on amounts drawn by the Company.

In subsequent events, the Company has previously reported that it has raised approximately $8.625M in gross proceeds in an underwritten public offering, pursuant to an effective Form S-1 registration statement, comprising the sale of 2.5 million shares plus 375,000 shares of an underwriters over-allotment option at a price of $3 per share, with no warrants issued in the transaction. Aegis Capital Corp. acted as sole bookrunner for the offering. The net proceeds to the Company after underwriter's commission and agreed upon customary fees and expenses were approximately $7.78 million, before deducting the Company's legal and accounting expenses related to the Offering.

With these cash inflows, the Company believes it has sufficient funding for its planned expenditures for the ensuing year, based on estimated budgets including costs of certain clinical trials.

In subsequent events, the Company previously reported that it is working on developing a therapeutic drug for the treatment of the novel coronavirus 2019-nCoV, aka COVID-19. In 2014, the Company had engaged in drug discovery efforts against MERS coronavirus. The Company has reported that it has already found broad-spectrum virus-binding ligands that are expected to attack the virus at the same points that the virus uses to bind to its cognate cellular receptor, namely ACE-2 (angiotensin converting enzyme type 2), using molecular modeling based on known SARS-CoV and ACE2 interactions. COVID-19 shares significant similarity with, and uses the same cellular receptor as, SARS-CoV. The Company intends to perform initial testing of these drug candidates for safety and effectiveness in cell culture studies in its own BSL-2 virology laboratory at its Shelton campus, using low-threat coronavirus strains that have been normally circulating in human population.

The Company is working on developing necessary collaborations to take the program further should an effective drug candidate be identified. However, there can be no assurance that the Company will be successful in entering into such collaborations or that such collaborations will lead to an effective drug candidate. The Company does not currently have a license for the coronavirus field from TheraCour Pharma, Inc. ("TheraCour"), the licensor of the Company's pharmaceutical candidates and a significant shareholder. Customarily, the Company enters into licensing agreements with TheraCour after a potential drug candidate is demonstrated to be likely effective against the virus. TheraCour has not previously denied any licenses sought by the Company.

The Company has experience developing broad-spectrum cellular receptor mimetics as virus-binding ligands for creating nanoviricide drugs. The Company has demonstrated this capability notably in its HerpeCide(TM) program, wherein nanoviricides based on the same antiviral ligand were found to be effective against at least three different kinds of herpesviruses, namely herpes simplex-1 (HSV-1), herpes simplex-2 (HSV-2), and, surprisingly, the non-simplex varicella zoster virus (VZV).

It is well recognized that development of vaccines takes a long time, and that vaccines can often be ineffective against viruses due to viral mutations that lead to emergence of resistant strains. It is also well recognized and well documented that monoclonal antibodies as antiviral drugs are very difficult to develop and often lead to emergence of resistant viral strains due to viral mutations.

In contrast, the Company believes that, its nanoviricide biomimetic technology platform has the potential to develop broad-spectrum antiviral drugs that viruses may not be able to escape due to mutations.

The Company continues to advance its first drug candidate, namely NV-HHV-101 skin cream, for the treatment of shingles rash as its first indication, towards human clinical trials. All of the planned IND-enabling Safety/Toxicology studies as well as other required non-clinical studies have been completed, and draft reports of various studies are being circulated between collaborating parties, as of the filing date. The Company anticipates receiving final cGLP reports for inclusion in our IND filing once the quality assurance processes are completed.

The Company has undertaken cGMP manufacture of the drug product, namely, NV-HHV-101 skin cream, indicated for the topical treatment of shingles rash, for supplying anticipated Phase I human clinical trials at its own facility. The Company has industry-leading internal expertise in the cGMP manufacture of complex nanomedicines drugs, right from simple starting materials to formulated drug products.

In a human skin patch organ culture model ex vivo, the Company has previously demonstrated the effectiveness and safety of topical NV-HHV-101 against VZV, the cause of shingles and chickenpox. These studies were conducted by Professor Jennifer Moffat at the Upstate Medical Center, SUNY Syracuse, NY. Professor Moffat has developed this model for pre-clinical evaluation of therapeutics against VZV, and is a well known expert in the field.

It is anticipated that the high effectiveness of our clinical drug candidate observed in this human skin model should be predictive of effectiveness in human clinical trials for topical dermal treatment of shingles.

Following shingles drug development, the Company anticipates developing drugs for HSV-1 cold sores and HSV-2 genital ulcers treatments using NV-HHV-101. The total market for our HerpeCide(TM) program drugs is estimated at several tens of billions of dollars because neither cures nor very effective treatments are available. The Company also has drug candidates in development at different pre-clinical stages in its Influenza and HIV drug programs. In addition, the Company has drug candidates against Dengue viruses, and was developing drugs against Ebola/Marburg viruses among others. The Company anticipates re-engaging these programs upon appropriate financing becoming available. Thus the Company has a rich and expanding pipeline of highly effective and safe drug candidates against a number of viral diseases.

NanoViricides is pioneering a unique platform for developing anti-viral drugs based on the "bind-encapsulate-destroy" principles. Viruses would not be able to escape a properly designed nanoviricide(R) drug by mutations because in doing so they would lose the ability to bind their cognate cellular receptor(s) and thus fail to infect productively, becoming incompetent.

There is a significant unmet medical need for the topical treatment of shingles rash. An effective therapy for shingles has been estimated to have a market size into several billions of dollars, if it reduces PHN incidence. An effective therapy for shingles rash reduction alone is estimated to have a market size of several hundred million dollars to low billion dollars. These market size estimates have taken into account the potential impact of the new Shingrix(R) GSK vaccine, assuming scaling up of their production in the 2024 time-frame, and the impact of the existing Zostavax(R) vaccine. Of note, the Shingrix vaccine has been found to cause significant, debilitating, side effects in as many as 15%-20% of the persons receiving it. Given that shingles is not a life-threatening disease (except under certain conditions), the uptake of such a vaccine with high incidence of adverse effects may be limited. Shingrix is not yet widely available.

The Company develops its class of drugs, that we call nanoviricides(R), using a platform technology. This approach enables rapid development of new drugs against a number of different viruses. A nanoviricide is a "biomimetic" – it is designed to "look like" the cell surface to the virus. The nanoviricide(R) technology enables direct attacks at multiple points on a virus particle. It is believed that such attacks would lead to the virus particle becoming ineffective at infecting cells. Antibodies in contrast attack a virus particle at only a maximum of two attachment points per antibody. In addition, the nanoviricide technology also simultaneously enables attacking the rapid intracellular reproduction of the virus by incorporating one or more active pharmaceutical ingredients (APIs) within the core of the nanoviricide. The nanoviricide technology is the only technology in the world, to the best of our knowledge, that is capable of both (a) attacking extracellular virus, thereby breaking the reinfection cycle, and simultaneously (b) disrupting intracellular production of the virus, thereby enabling complete control of a virus infection.

About NanoViricides

NanoViricides, Inc. (www.nanoviricides.com) is a development stage company that is creating special purpose nanomaterials for antiviral therapy. The Company's novel nanoviricide(R) class of drug candidates are designed to specifically attack enveloped virus particles and to dismantle them. Our lead drug candidate is NV-HHV-101 with its first indication as dermal topical cream for the treatment of shingles rash. The Company is also developing drugs against a number of viral diseases including oral and genital Herpes, viral diseases of the eye including EKC and herpes keratitis, H1N1 swine flu, H5N1 bird flu, seasonal Influenza, HIV, Hepatitis C, Rabies, Dengue fever, and Ebola virus, among others. The Company's technology is based on broad, exclusive, sub-licensable, field licenses to drugs developed in these areas from TheraCour Pharma, Inc.

Contact:
NanoViricides, Inc.
info@nanoviricides.com

Public Relations Contact:
MJ Clyburn
TraDigital IR
clyburn@tradigitalir.com

This press release contains forward-looking statements that reflect the Company's current expectation regarding future events. Actual events could differ materially and substantially from those projected herein and depend on a number of factors. Certain statements in this release, and other written or oral statements made by NanoViricides, Inc. are "forward-looking statements" within the meaning of Section 27A of the Securities Act of 1933 and Section 21E of the Securities Exchange Act of 1934. You should not place undue reliance on forward-looking statements since they involve known and unknown risks, uncertainties and other factors which are, in some cases, beyond the Company's control and which could, and likely will, materially affect actual results, levels of activity, performance or achievements. The Company assumes no obligation to publicly update or revise these forward-looking statements for any reason, or to update the reasons actual results could differ materially from those anticipated in these forward-looking statements, even if new information becomes available in the future.

Important factors that could cause actual results to differ materially from the company's expectations include, but are not limited to, those factors that are disclosed under the heading "Risk Factors" and elsewhere in documents filed by the company from time to time with the United States Securities and Exchange Commission and other regulatory authorities. Although it is not possible to predict or identify all such factors, they may include the following: demonstration and proof of principle in preclinical trials that a nanoviricide is safe and effective; successful development of our product candidates; our ability to seek and obtain regulatory approvals, including with respect to the indications we are seeking; the successful commercialization of our product candidates; and market acceptance of our products. FDA refers to US Food and Drug Administration. IND application refers to "Investigational New Drug" application. CMC refers to "Chemistry, Manufacture, and Controls".

SOURCE: NanoViricides, Inc.

Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

The Strength and Potential of China Medical System (867.HK) Reflected in an Untenable Short Selling Attack

HONG KONG, Feb 20, 2020 – (ACN Newswire) – 1. Targeted by a short seller, China Medical System fought back with a strong response and large-scale buyback













In recent years it has been common for short sellers who are active in the Hong Kong stock market to target "high-performing stocks". However, most of these actions have been in vain, the targeted companies with solid fundamentals have withstood these tests and their stock prices performed well again in the secondary market, fighting back against the short sellers.

Recently, the short-seller Blue Orca issued a short selling report of China Medical System, a domestic high-quality pharmaceutical company. In this report releasing in early February, Blue Orca accused China Medical System of inflating profits and its chairman's misusing of the listed company's profits for his personal gain.

China Medical System quickly issued a strong response responding to each of the key points in Blue Orca's allegations. The response also stressed that these allegations were groundless, seriously misleading with untruthful conclusions. Then Blue Orca released a second report which is similar to the first one on February 10. In response, China Medical System further denied all the allegations made in both reports, and claimed that all the allegations were false due to the ignorance of the company's business structure, applicable tax policies and regulations, and audit process and these allegations are based on incomplete information that was inconsistent with the facts.

Despite the round of confrontation, the share price of China Medical System has not been frustrated, presenting a stable trend and rebounding in the following days. It is worth mentioning that after the short sale, China Medical System bought back 9.648 million of its shares at the cost of HK$ 98.1641 million on February 11. This action not only shows the strong confidence that China Medical System has in its future development but also showcased the company's sincerity to its minority shareholders and determination of defending against short selling. The company's shares continue to be in popular demand since the short sale on February 6, with a cumulative increase of 9.8% as of February 14. The response in the capital market clearly demonstrates the failure of Blue Orca's long planned short sale.

2. China Medical System gives strong response to the allegations. Why the company is so confident?

As a Chinese idiom goes, "If you stand straight, do not fear a crooked shadow," when facing Blue Orca's attack, China Medical System not only strongly responded to various allegations in announcement, but also asserted its confidence through a large-scale buyback. The following is a discussion of key views of the confrontation and an analysis of why the Blue Orca's short selling is untenable.

First, Blue Orca questioned the performance of China Medical System, claiming that the net profit margin of the company's Chinese branches was significantly lower than the group, and further claiming that the profits from its Malaysian subsidiary were fictitious. In response, China Medical System pointed out that its Malaysian subsidiary, with independent rented offices and employees, undertakes the main international business functions of the company, including new product investment and introduction, manufacturer selection and evaluation, quality control and supply chain management, promotion strategy formulation, etc., and by the end of 2018, its accumulated intangible asset expenditure had reached RMB 2.85 billion.

In fact, given that only a few listed pharmaceutical companies are involved in large-scale international trade, it is not fair to simply compare the business data of China Medical System with other pharmaceutical companies and thoughtlessly conclude that China Medical System exhibited business performance of fraud. Furthermore, from the perspective of China Medical System's business system, the involved transnational businesses and corresponding structures, established with the assistance of professional tax consultants, are designed to undertake different functions and risks domestically and abroad, then generated corresponding profits, which is a normal business activity and common practice in multinational enterprises. Therefore, the profits of its Malaysian subsidiary really exist, and the profits of the Chinese branches do not represent the overall profit level of China Medical System as a whole.

In fact, the past financial performance and dividend payout further authenticate China Medical System's operation. Since listed in Hong Kong, China Medical System has maintained 40% of net operating profit as its dividend payout for nine consecutive years, totaling RMB 3.95 billion. Publicly disclosed total projects investment is about RMB 4.7 billion. Before 2016, the year-end bank loan balance of China Medical System totaled about RMB 300-400 million; from 2016 to 2018, the year-end bank loan balance of the company was about RMB 1.6 billion, RMB 2.1 billion and RMB 1.4 billion and with a gearing ratio of 16.5%, 20.7% and 13.9% respectively. The gearing ratio of the company has remained at a relatively low level for a long time. Since listed in Hong Kong, the direct equity financing of China Medical System totaled only about HK$ 1.7 billion. If, according to Blue Orca, 49% of the company's profit was fictitious, then the cash flow would have made it difficult to maintain its normal investments, operations and dividend payout. The company would have been stuck in the mud of cash flow fracture. In light of this, the seemingly exaggerated data argument of Blue Orca is obviously not reliable. At the same time, the long-term performance of China Medical System has obviously registered a soaring growth. Ten years period from 2009 to 2018, the CAGR of its revenue, excluding the effects of the two-invoice system, reached 28.1% and the CAGR of its profits reached 32.9%. Since its listing, the company has been audited by Deloitte, an internationally renowned accounting firm, and its market value has more than tripled.

Second, the other allegation made by Blue Orca mainly claimed that China Medical System, as a listed company, secretly funded the R&D of its chairman's private company as well as transferred benefits for its chairman's investment activities.

The root cause of Blue Orca's allegation lay in its lack of in-depth understanding of the company. In 2015, due to the uncertainty of the policy environment and the expectation of new product launching, Mr. Lam Kong, Chairman of China Medical System, made equity investments. After the successful commercialization of the product in which Mr. Lam Kong invested, China Medical System would then intervene and give Mr. Lam Kong a reasonable return. These were reasonable business decisions and protected the interests of shareholders. After the policy became clear and the team accumulated investment experience, China Medical System gradually explored the model of joint investment by both the listed company and the chairman, and, in some cases, independent investment by the listed company alone. It is in fact a meticulous design made by the company's founder. On the one hand, as a former medical practitioner, Mr. Lam Kong strives to bring an increasing number of highly innovative, affordable pharmaceutical products which can meet unmet clinical needs of the Chinese market to patients. On the other hand, as a businessman, he has to balance the risks to ensure the company's future operation and protect the interests of shareholders. Therefore, he chose to invest in the new products projects together with the listed company at the same price and in the same proportion. In this way, the investment risk of the listed company can be shared with Mr. Lam, while the listed company acquires rights of the target company's products in addition, so as to realize win-win outcomes among the listed company, its major shareholders, minor shareholders and the management. Thus, China Medical System's detailed response on each project demonstrates that the Blue Orca made false allegations regarding specific project details.

In conclusion, China Medical System counterattacked the short seller by its strength. Notably, this short selling attack by Blue Orca was not only unscrupulous due to the current epidemic and the weakening risk preference in the capital market, but was also doomed to fail from beginning because the lack of convincing evidence.

3. China Medical System can withstand the tests of time, and win the future with its innovative model

China Medical System, which has been operating for the last 25 years as a low-profile company in the Chinese pharmaceutical industry, has long withstood both the tests of time and of the market. As a pharmaceutical enterprise with profound experience, China Medical System also enjoys a special position and irreplaceable value in the pharmaceutical industry chain. It firmly focuses on two core parts of the industrial value chain: product research and evaluation and professional academic promotion.

From the perspective of product R&D model, the R&D innovation of China Medical System differs from the simple self-established R&D or the pure introduction of products for sales. Instead, it effectively integrates two elements and forms the "S+D" (Search & Development) model. This unique "China Medical System Model" not only, to a certain extent, avoids the huge risks and investments of independent R&D, but also ensures its ability in product innovation and control. With its own edge in domestic and overseas resources, this China Medical System R&D model also ensures its strength to compete in the market, thus building a strong core competitiveness.

In just two years, China Medical System has made great achievements in its innovation. It has invested in 7 R&D companies in the United States, the United Kingdom, France and Switzerland; has strategically cooperated with 4 R&D (pharmaceutical) companies in India and Israel; has obtained 19 innovative products in total, 6 of which have been approved for launching overseas, 1 of which is under FDA's approval process, and 5 of which are in phase III clinical stage, so as to ensure that innovative products can be successively launched into the market in the short-, medium- and long-term. The total annual sales potential of four overseas approved or to be approved innovative products are expected to exceed RMB 10 billion.

The sound historical sales records of China Medical System's main products and its selling expense ratio which at the low level of the industry, making its professional academic promotion ability obvious to all. Since its listing in 2010, the annual selling expense ratio, excluding the impact of "two-invoice system", for China Medical System has remained at about 22%. In the context of increasingly strict anti-corruption and compliance control in the industry, the lower-expense-ratio promotion model also reflects the efficiency and compliance of China Medical System's promotion network. A professional academic promotion network serves as the most suitable foundation for the promotion and development of innovative products, and is also an important weapon for China Medical System to best their competition.

4. Conclusion

As the Chinese sayings goes, "only the toughest grass can bear strong winds". From this short selling incident, China Medical System did not suffer from it, but demonstrated a high-quality enterprise who can withstand test to investors. Up to now, many sell-side researchers in the market have also given China Medical System a favorable rating. For example, Phillip Securities Group, in its latest research report, maintained the "overweight" rating with a target price of HK$ 13.35; Credit Suisse raised the target price of China Medical System to HK$ 14.05 at the end of January, and maintained its rating of "outperforming"; Morgan Stanley also gave the target price of HK$ 14.6. In considering of its valuation, the company's current dynamic PE is about 11 times, at the bottom of the historical range.

The current lower valuation of China Medical System may due to two reasons. Firstly, the market worried about the impact of China's centralized procurement policy on its existing products, Deanxit and Plendil. However, this policy has been continuously optimized and adjusted, and at present only products with more than two generics consistency passing would be included in the centralized procurement list. According to the inquiry, only one generic of Deanxit has passed the consistency evaluation, while no generics of Plendil have passed this evaluation. Therefore, in the short term, the centralized procurement policy will have no impact on the products of China Medical System. At the same time, the company has also invested in some competitive generics which are supposed to launch to the market as soon as possible, grasping the policy benefit to gain additional revenue. Secondly, the market does not have a comprehensive understanding of the company's transformation, especially its innovative product pipeline. Currently, the company has four innovative drugs approved or to be approved overseas with great market potential, are in the registration process for China market approval. Once they are approved in China, the innovative product pipeline of China Medical System will be confirmed by the market and bring improvement to the company's sales performance. Therefore, the current share price of China Medical System still has a large space for restoration.

In retrospect, China Medical System has withstood the long-term tests from time and the market, creating generous returns for shareholders, and also continuing to make contributions to the development of the Chinese pharmaceutical industry. Looking forward, China Medical System will proactively conform the development direction of industry reform with its innovative business model, and continue to strengthen its core values in the entire pharmaceutical industry chain, and enhance its own competitive security margin. It can be concluded that both its current and past excellent performance, along with its long-term core competitiveness, give China Medical System a huge space for imagination in the future.




Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

Holista Partners GICC LLC, the U.S. Developer of Path-Away(R), to Co-Develop Nasal Sanitising Balm for Global Markets

KUALA LUMPUR/PERTH/BLUFFTON, Feb 20, 2020 – (ACN Newswire) – Holista CollTech (ASX:HCT) ("Holista") announced today it will co-develop and produce in Malaysia the world's first nasal sanitising balm using Path-Away(R), a plant-based alcohol-free active ingredient that has proven successful in killing all previously tested corona type viruses without harming humans.

Path-Away(R), which has been tested and proven to kill more than 170 pathogens (including viruses, bacteria, and fungi), was developed by Global Infection Control Consultants LLC ("GICC LCC"). It kills the AIDS virus and the resilient Mycobacterium tuberculosis. In Malaysia, it is approved by the Ministry of Health as being effective against the H1N1 virus. GICC LLC, based in Bluffton, South Carolina, was founded by President and Principal Research Scientist, Dr Arthur Martin.

CO-DEVELOPMENT OF NASAL SANITSING BALM FOR GLOBAL MARKETS

Dr Martin and Dr Rajen Manicka, founder and CEO of Holista, jointly announced, "following the outbreak of Covid-19, the two companies will extend their partnership and accelerate the development of the nasal sanitising balm which will contain Path-Away(R)".

The two companies expect to jointly file a global patent on the nasal sanitising balm first quarter of 2020, and intend to commence production by the third quarter of 2020, ahead of distribution to global markets and the onset of the UK and European winter.

The balm will include Path-Away(R), which is created from a series of individual plants and processes proprietary to GICC LLC. Path-Away(R) attaches to the virus and weakens the cell walls by inhibiting its ability to take up amino acids – the basic building block of cells. This forces the virus cells to clump together, in the process of killing themselves, almost instantly.

Dr Martin said "An airborne virus can only enter the human body through the eyes, the mouth and the nose. The mouth is protected by salivary enzymes and the eyes produce tears with specific enzymes that disable proteins on virus surfaces. The nose, however, is warm, damp and dark especially during winter. Rich in fatty and amino acids, the nasal passage leads directly to sinuses, the throat and of course, the lungs, thus making it the most vulnerable to viruses."

"We are pleased to partner with Holista to develop a nasal sanitising balm equivalent of NatShield(TM) Sanitizer as masks do not provide complete protection to the nose as they are loose-fitting and may allow small droplets to enter the mouth or nose. Since Path-Away(R) is plant-based and alcohol-free, it does not irritate the nose and will be effective for six hours", he added.

UPDATE ON HAND-HELD SANITISER; APPOINTMENT OF BOTTLERS IN THE PHILIPPINES

The hand-held NatShield(TM) Sanitiser, containing Path-Away(R) and developed by Holista is currently bottled in Malaysia and distributed within the 10-country ASEAN region. Stocks have run out in local pharmacies and Holista said today it has appointed three bottlers in the Philippines to meet orders.

Dr Rajen Manicka, CEO of Holista CollTech, said, "Due to health concerns about Covid-19, Holista is striving to meet the demands for the hand-held NatShield(TM) Sanitiser locally in Malaysia as well as in Australia".

DISTRIBUTION EXTENDED BEYOND ASEAN TO INCLUDE THE UK AND EUROPE

GICC LLC has agreed to grant Holista marketing and distribution rights of Path-Away (R) beyond ASEAN region to include UK and Europe. Holista will distribute NatShield(TM) Sanitiser and the nasal sanitising balm into the UK and Europe. Holista will also work collaboratively with GICC LLC in the North American market to market NatShield(TM) Sanitiser and the nasal sanitiser balm.

"We are also grateful to Dr Martin and GICC LCC for granting Holista the distribution rights for Path-Away(R) to include the UK and Europe. We are excited to collaborate Dr Martin's team in the North American market on the Natshield(TM) Sanitiser," he added.

EQUIPMENT TO CLEANSE AIRFLOW IN BUILDINGS & FACILITIES

Under the leadership of Dr Martin, a trained engineer, GICC LCC has also developed a set of equipment and processes that helps deploy Path-Away(R) in buildings such as airports, transportation hubs, hospitals, schools and factories to improve the quality airflow. The solution involves pumping mists containing Path-Away(R) into the air condition and ventilation systems to destroy the deadly pathogens present in such enclosed public spaces.

It has been used for over a decade in various countries and market segments to prevent illness and to increase productivity.

GICC LLC has previously helped Malaysia during the H1N1 outbreak in 2009 and Singapore during the SARS outbreak in 2003 using Path-Away(R).

Holista will now exclusively represent this technology in the Asia Pacific region except for China, Macau, Hong Kong and Taiwan.

FUNDING UPDATE

As announced to the ASX earlier this month, the Company has successfully raised just over $2,600,000 since the start of 2020, utilising the Acuity Capital Control Placement Agreement (CPA) facility. This funding will provide the capital to develop the nasal sanitising balm, grow existing regional markets as well as new European markets without disrupting business operations.

About Holista CollTech Ltd

Holista CollTech Ltd ("Holista") is a research-driven biotech company, the result of a merger between Holista Biotech Sdn Bhd and CollTech Australia Ltd. Headquartered in Perth and with extensive operations in Malaysia, the company is dedicated to delivering first-class natural ingredients and wellness products globally. Holista is a leader in the research of herbs and ingredients for the making of healthier food.

Listed on the Australian Securities Exchange (ASX:HCT), Holista researches, develops, manufactures and markets "health-style" products to address the unmet and evolving needs of natural medicine. Holista's suite of ingredients, among other things, includes low-GI baked products, reduced-sodium salts, low-fat fried foods and low calories sugar without compromising taste, odour and mouthfeel. Holista remains the only company to produce sheep (ovine) collagen using patented extraction methods. For more information, please refer to http://www.holistaco.com

Contact:
Corporate Affairs & Business Opportunities
Dr Rajen Manicka: rajen.m@holistaco.com
General Enquiries: enquiries@holistaco.com

Media and Investor Relations:
WeR1 Consultants Pte Ltd
E: holista@wer1.net; P: +65 67374844

Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

DNX Biopharmaceuticals Announces Collaboration with Lung Cancer Initiative at Johnson & Johnson

SAN DIEGO, CA, Feb 19, 2020 – (ACN Newswire) – DNX Biopharmaceuticals, a biopharmaceutical company developing long-acting therapeutic proteins for the treatment of patients with life-long diseases and a resident of Johnson & Johnson Innovation – JLABS @ Shanghai, announced today that it has entered into a strategic collaboration with the Lung Cancer Initiative at Johnson & Johnson*. Under terms of the agreement, the Lung Cancer Initiative has taken an exclusive license to research, develop and commercialize novel molecules from within the DNX portfolio. Financial terms of the collaboration were not disclosed.

"We are delighted to be collaborating with the Lung Cancer Initiative at Johnson & Johnson," said Rajiv Datar, Ph.D., co-founder and CEO of DNX. "We look forward to progressing DNX's novel molecules into clinical development."

"Our collaboration with the Lung Cancer Initiative at Johnson & Johnson was fostered by being an awardee of the Lung Cancer Innovation QuickFire Challenge and receiving residency at Johnson & Johnson Innovation – JLABS, Shanghai," commented Dr. Carl Edwards III, CSO of DNX. "We are now looking forward to establishing our Asia-Pacific Research and Development capabilities in Shanghai, which will be wholly dedicated to Cancer Immunotherapy."

About DNX Biopharmaceuticals, Inc.

Founded in 2014 and headquartered in San Diego, California, USA, DNX is a biopharmaceutical company developing non-immunogenic, long-acting biologic therapies for the treatment of patients with life-long diseases linked to inflammation, autoinflammation and oncology. As an awardee of the Lung Cancer Innovation QuickFire Challenge, DNX received residency at Johnson & Johnson Innovation – JLABS @ Shanghai. At JLABS in Shanghai, DNX will pursue an ongoing R&D effort that leverages its intrinsically disordered protein technologies designed to explore the tumor microenvironment, leading to the identification of novel pathways that can be targeted with molecules to substantially influence "anti-tumoral" therapeutic responses. Ongoing nonclinical efforts have identified several novel candidates that may act as "Immune Checkpoint Inhibitors" alone or in combination with existing standard of care anti-PD-1 and CTLA-4 therapies to reverse CD8+ T cell functions, all with the aim of improving clinical outcomes across the vast range of cancer conditions. For more information, please visit www.dnxbio.com.

*Johnson & Johnson Enterprise Innovation Inc. is the legal entity to the agreement.

Media Contact:
Claude Gingras, CFO
Claude.Gingras@dnxbio.com

Related Links
– J&J Announcement of the Winners of the Lung Cancer QuickFire Award
https://www.newsfilecorp.com/redirect/XmpnIyDP

To view the source version of this press release, please visit https://www.newsfilecorp.com/release/52493

Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

AIM ImmunoTech Issues Stockholder Update on the Potential Role of Ampligen for Use Against the Wuhan Coronavirus Epidemic

OCALA, FL / ACCESSWIRE, Feb 18, 2020 – (ACN Newswire) – AIM ImmunoTech (NYSE American: AIM), an immuno-pharma company focused on the research and development of therapeutics to treat immune disorders, viral diseases and multiple types of cancers, today provided its stockholders with an update on its efforts to develop Ampligen as a protective therapeutic and a vaccine in the new coronavirus epidemic. Ampligen, the company's flagship drug, has a commercial approval in Argentina, early-access therapeutic approval in the Netherlands, and is in numerous FDA-authorized clinical trials in the United States. This letter provides a detailed scientific basis for why the company is moving forward in the important and volatile Wuhan coronavirus space. The text of the letter is set forth below and also is available on the company's website.

Dear Valued Stockholder:

As you know, our primary focus over the past two years has been on Ampligen (rintatolimod) in immuno-oncology. That remains our top priority. Nevertheless, mankind is faced with its third emerging highly pathogenic and deadly human coronaviral threat in less than two decades. We are referring to the lethal Wuhan Coronavirus, in which the disease is technically known as COVID-19 (Coronavirus disease-2019), in which the first cases were observed in Wuhan, China, only two months ago. Today there are more than 60,000 cases with well over 1,000 confirmed deaths. This virus thrives in hospital-like settings. In a recent study of infections contracted in hospitals, there was a 4.3% mortality rate (https://jamanetwork.com/journals/jama/fullarticle/2761044). The urgency of the situation only increases day by day, and any mutation which increases mortality would have major global consequences in a pandemic. It is for this reason that I directed the AIM ImmunoTech team to reexamine the antiviral properties of Ampligen in conjunction with the known genomic properties of the Wuhan coronavirus and its clinical syndrome, and the potential of Ampligen to serve as a protective therapeutic in such high-risk environments.

To date, we have as step one developed the ideas behind our potential Wuhan outbreak therapy and vaccine. Next, we filed provisional Ampligen patent applications related to the Wuhan coronavirus (see: https://aimimmuno.irpass.com/AIM-ImmunoTech-Files-Three-Provisional-Patent-Applications-Surrounding-AmpligenR-for-Use-Against-the-SARS-like-Wuhan-2019-Novel-Coronavirus). Now, we are moving aggressively to bring our findings to the governments of the U.S., China and Japan.

When the Wuhan coronavirus outbreak first emerged, our AIM ImmunoTech team went to work immediately. Our drug Ampligen had excellent antiviral activity against the coronavirus SARS in U.S. National Institutes of Health (NIH)-contracted animal experiments, conferring 100% protective survival.

In the Day 2009 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2787736/) and Barnard 2006 (https://journals.sagepub.com/doi/abs/10.1177/095632020601700505) NIH studies of SARS-infected mice, Ampligen stood out as the only drug conferring a significant antiviral/survival effect. We knew, if the Wuhan virus shared key genomic and pathogenic similarities with SARS, we may have important insight into developing a potential protective early-onset therapy for this new lethal virus where currently there is no effective therapy. Again, the Wuhan coronavirus is especially virulent in hospital and institutional quarantine settings, so such prophylactic protective measures may help blunt the spread of the disease.

Rapidly, we obtained genomic RNA sequences of the new virus and compared them to the SARS virus' RNA sequences. As you will see in the section following the synopsis of the SARS experimentation with Ampligen in animals, the RNA sequences of the SARS virus in key areas of viral replication are almost identical for the Wuhan coronavirus. Therefore, we believe it is very likely that Ampligen would have similar antiviral activity against the Wuhan coronavirus as it did against the SARS-CoV. These experimental evaluations of Ampligen as an antiviral treatment for SARS took place after the last SARS outbreak about 15 years ago. At that time, Ampligen was the only therapy which, in the NIH-contracted animal experiment, conferred significant efficacy, up to 100% survival as compared to 100% mortality in the SARS infected control group. In these two studies (Barnard 2006 and Day 2009), SARS mouse models were evaluated and the Ampligen dose utilized in these studies yielded antiviral and survival effects, i.e. reduction of SARS virus lung titers below the level of detection (Barnard 2006) and increased survival (Day 2009). Importantly, these effects were obtained at clinically achievable/tolerated human dosage levels. Ampligen was the only drug active at clinically achievable serum/dosage levels (Strayer 2014 http://www.eurekaselect.com/123324/article). Barnard (2006) studied the ability of Ampligen and rIFN-aB/D to inhibit SARS virus (Urbani Strain) titers in the lungs of BALB/c mice. Complete inhibition to below detectable levels was seen with Ampligen at 10 mg/kg which is equivalent to 700 mg in an average weight human (70 kg) and has also been shown to be a generally well-tolerated dosage level (Thompson 1996 https://www.ncbi.nlm.nih.gov/pubmed/8874076). The rIFN-aB/D inhibited virus titers to below detectable level, but required a dose of 100,000 IU in mice, which is equivalent to an extremely high human dose of 500 x 106 IU, and furthermore is not clinically available. Day (2009) studied a new mouse-adapted strain of SARS-CoV as a lethal model. Only Ampligen at a dosage of 10 mg/kg/day obtained a 100% survival rate.

In summary, only Ampligen showed any significant response when evaluating protection and survival (Day 2009, Barnard 2006 and Strayer 2014). The above SARS-related experiments indicate that, unlike other drugs, Ampligen has a significant positive prophylactic early-onset therapeutic effect. Further, Ampligen has demonstrated significant synergy when combined with otherwise marginally effective antivirals to enhance antiviral therapy programs in other viruses. While there is currently no therapy for the Wuhan coronavirus, if a future traditional-based antiviral therapy is developed for this coronavirus, we believe that the combination of traditional antiviral therapies and Ampligen may produce a synergistic effect similar to what we have seen with Ampligen in other viruses that serves to improve performance, because Ampligen's immunological mechanism of action is both different and complementary to the typical antiviral. (See: "Ampligen as an Antiviral," slides 46-50, at https://aimimmuno.com/events-presentations/).

We believe the significant similarity of the Wuhan coronavirus to SARS suggests Ampligen has a high probability of a similar potential efficacy against the Wuhan coronavirus. Our analysis comparing key transcription regulatory sequences of SARS to the Wuhan coronavirus wherein we analyzed the similarity between SARS-CoV and the Wuhan coronavirus found significant and compelling similarities. Our results are listed in Table 1 and discussed below. These similarities among the analyzed sequences suggest possible extension of the antiviral effects of Ampligen seen in SARS experiments to that of Wuhan coronavirus. We provide this extra detail for those of you who are interested in a deeper analysis – however, the short story is that we have a remarkable 99% similarity in these key areas.

Coronavirus replication uses a unique transcription mechanism for the creation of nested sets of mRNAs. Selection of the correct reading frame for each mRNA is provided by transcription-regulating sequences (TRSs). Our comparison of the TRS (transcription regulatory sequences) of the first five open-reading frames (ORF) of SARS-CoV identified by Mara (2003) (https://science.sciencemag.org/content/300/5624/1399.long) to the Wuhan coronavirus responsible for COVID-19 is shown below in Table 1.

Table 1. TRS sequence comparison of two Highly Pathogenic Human Coronaviruses (HPHuCoV)
HPHuCoV / Base / ORF* / TRS Sequence**

SARS 60 / Leader / UCUCUAAACGAACUUUAAAAUCUGUG
Wuhan 63 / UCUCUAAACGAACUUUAAAAUCUGUG

SARS 21,479 / S (spike) / CAACUAAACGAAC
Wuhan 21,549 / CAACUAAACGAAC

SARS 25,252 / ORF3 / CACAUAAACGAACUU
Wuhan 25,378 / CACAUAAACGAACUU

SARS 26,104 / Envelope / UGAGUACGAACUU
Wuhan 26,232 / UGAGUACGAACUU

SARS 26,341 / M / GGUCUAAACGAACUAACU
Wuhan 26,466 / GGUCUAAACGAACUAAAU

*Open Reading Frame (i.e.-encodes for a protein)
**Marra, et al. https://science.sciencemag.org/content/300/5624/1399.long

We see that the TRS for the first five ORFs for the SARS-CoV (Tor2) compared to the Wuhan-CoV virus recently isolated from a patient with a SARS-like illness in China is identical with the exception of a single nucleotide (C/A) for the Membrane (M) coronavirus protein. Thus, four of the five TRS sequences (Leader, S (spike), ORF3, and Envelope) are identical for the SARS-CoV compared to the Wuhan-CoV isolate. The M protein has a single nucleotide change: the A in the SARS-CoV is changed to a C in the Wuhan-CoV. Thus, the TRS sequences of these two coronaviruses are almost identical with 84/85 nucleotides the same (99% homology).

An important pathogenic feature of SARS-CoV disease and COVID-19 is that they both utilize the same ACE2 receptor to bind to and infect a human cell. This ACE2 receptor similarity, along with the similarity of the analyzed key regulatory viral genomic sequences show, with reasonable probability, that the functional effects of Ampligen in these SARS experiments will likely extend to the Wuhan coronavirus. This is important because no effective protective therapy currently exists for a disease that is demonstrating high levels of nosocomial transmissibility – which means you easily catch it in hospital-like settings. This virus thrives in hospital-like settings. That means health care workers and exposed persons desperately need an effective protective early-onset therapeutic.

In addition to Ampligen as an antiviral, we have developed a vaccine concept, which would utilize an inactivated Wuhan/coronavirus vaccine plus Ampligen to create a vaccine that would likely immunize against the specific viral targets and would also confer cross-protection against mutations of the coronavirus and other similar coronaviruses, potentially creating, in effect, a potential universal coronavirus vaccine.

Influenza presents a meaningful analogy. The AIM-sponsored clinical results in humans seen in the Overton (2014) paper and the Ichinohe/Hasegawa (2007 and 2010) experimental results in mice and monkeys as stated in the papers show how, in influenza, Ampligen as a double-stranded RNA (dsRNA) and a generally well-tolerated selective toll-like receptor 3 (TLR3) agonist with induction of innate and adaptive immune responses has a powerful immunological impact on a vaccine's activity in mice, non-human primates and humans showing evidence of epitope spreading and cross-protection/cross-reactivity. TLR3 is expressed in high concentrations on human airway epithelial cells and serves as a recognition system initiating innate and subsequent adaptive immune responses for many respiratory pathogens.

The mucosal surface of the nose and respiratory tract serve as an ideal environment for Ampligen, as a TLR3 agonist, to exert its pronounced ability to enhance the innate and adaptive immune responses to respiratory pathogens such as influenza virus, adenovirus, and coronavirus. Indeed the intranasal instillation of inactivated or attenuated influenza viruses contained in seasonal influenza vaccination, when used in combination with Ampligen, has been shown to be able to induce a broad cross-reactivity antiviral IgA response to influenza viruses highly pathogenic to humans, such as various H5N1 clades (A/Indonesia/5/2000, A/HongKong/483/97, and A/Vietnam/1194/2004) in mice, non-human primates, and humans. See Overton 2014 https://www.sciencedirect.com/science/article/pii/S0264410X14010457?via%3Dihub, Ichinohe 2007 https://academic.oup.com/jid/article/196/9/1313/2191831, and Ichinohe 2010 https://onlinelibrary.wiley.com/doi/abs/10.1002/jmv.21824)

The unique ability of Ampligen to be able to enhance in humans the mucosal IgA response to both homologous and heterologous strains of influenza virus is dependent on the interaction at the mucosal environment with Ampligen and the foreign protein epitopes present in the viruses. This interaction results in epitope spreading to less responsive common antigens with the generation of secretory IgA (S-IgA) resulting in a very broad cross-reactivity against more distantly related clades and even strains of viruses not previously encountered. We believe this may be the key to a "universal" vaccine.

The use of intranasal vaccination for respiratory viral pathogens has several advantages over standard intramuscular (IM) or subcutaneous (SQ) approaches: 1) neutralizing antibodies can be generated at the point of respiratory entrance- the airway mucosa rather than systemic, 2) vaccination could be self-administered if required, and 3) there is the potential of epitope spreading. Our proposed vaccine contemplates inactivated Wuhan-CoV, a similar inactivated isolated virus from patients, or an antigen thereof, combined with Ampligen and administered intranasally (IN), with the generation of a mucosal S-IgA response and consequently having potentially a broad cross-reactivity against other coronaviruses, including SARS, MERS, and the Human Coronaviruses 229E, NL63, and OC43. We believe, similar to the influenza results we obtained in humans described in the above link to the Overton study and the Ichinohe/Hasegawa animal experiments, that this potentially universal coronavirus vaccine may demonstrate antiviral activity not only against currently identified coronaviruses, but also against newly emerging coronaviruses resident in wild animal populations with the potential to emerge in the future to infect human populations similarly to SARS, MERS, and Wuhan CoV, or mutations from existing coronaviruses.

Finally, as you know from our ability to deploy Ampligen in immuno-oncology clinical trials over the past two years, Ampligen has a well-developed safety profile for human use. Our safety profile involves approximately 100,000 generally well-tolerated intravenous (IV) doses in humans in FDA authorized clinical trials up through Phase 3. We have also completed a Phase 1 safety trial for intranasal administration of Ampligen, which would be highly advantageous to creating a universal intranasal coronavirus vaccine for humans (Overton 2014, see link above). Ampligen has been authorized for use in humans in numerous ongoing clinical trials (primarily in oncology) and in a long-term compassionate care program (ME/CFS) by the U.S. FDA. Ampligen has received full commercial approval (ME/CFS) from the Republic of Argentina. Ampligen has an early access use approval for use in pancreatic cancer from the Netherlands. Our drug Ampligen is generally well-tolerated, which makes it primed and ready for Wuhan coronavirus clinical trials in China or any other site with sufficient subjects.

This has been a major effort for our team over the past six weeks. As noted above, we have filed provisional patent applications to protect our ideas in applying Ampligen as a protective therapeutic and a vaccine in this newest coronavirus epidemic. We waited until our patent applications were filed to discuss in detail our efforts, so as to protect the rights to these ideas to the greatest extent possible. Now we begin the process of seeking government partners to develop Ampligen as both a protective therapy and a vaccine in China and other affected areas.

We believe our work here is very important and, especially when dealing with a potential pandemic, consistent with AIM's corporate motto: "Immunology for a better future."

All the best,
Thomas K. Equels, CEO
AIM ImmunoTech Inc.
Tel: (352) 448-7797
www.AIMimmuno.com

About AIM ImmunoTech Inc

AIM ImmunoTech Inc. is an immuno-pharma company focused on the research and development of therapeutics to treat immune disorders, viral diseases and multiple types of cancers. AIM's flagship products include the Argentina-approved drug rintatolimod (trade names Ampligen(R) or Rintamod(R)) and the FDA-approved drug Alferon N Injection(R). Based on results of published, peer-reviewed pre-clinical studies and clinical trials, AIM believes that Ampligen(R) may have broad-spectrum anti-viral and anti-cancer properties. Clinical trials of Ampligen(R) include studies of cancer patients with renal cell carcinoma, malignant melanoma, colorectal cancer, advanced recurrent ovarian cancer and triple negative metastatic breast cancer. These and other potential uses will require additional clinical trials to confirm the safety and effectiveness data necessary to support regulatory approval and additional funding. Rintatolimod is a double-stranded RNA being developed for globally important debilitating diseases and disorders of the immune system.

Cautionary Statement

This press release contains forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. Words such as "may," "will," "expect," "plan," "anticipate" and similar expressions (as well as other words or expressions referencing future events or circumstances) are intended to identify forward-looking statements. These statements involve a number of risks and uncertainties. For example, significant additional testing and trials will be required to determine whether Ampligen will be effective in the treatment of the Wuhan Coronavirus in humans and no assurance can be given that it will be the case. The press release references a number of studies. No assurance can be given that future studies will not result in findings that are different from those reported in the referenced studies. The filing of provisional patent applications provides no assurance that patents will ultimately be granted. The Company will be reaching out to numerous foreign governments and, if successful, will be working in these countries. Operating in foreign countries carries with it a number of risks, including potential difficulties in enforcing intellectual property rights. We cannot assure that our potential operations in foreign countries will not be adversely affected by these risks. Please note that certain doctors who were executives of the Company were co-authors of some of the studies referenced herein. With regard to the Company's activities with Ampligen generally, no assurance can be given as to whether current or planned trials will be successful or yield favorable data and the trials are subject to many factors including lack of regulatory approval(s), lack of study drug, or a change in priorities at the institutions sponsoring other trials. In addition, initiation of planned clinical trials may not occur secondary to many factors including lack of regulatory approval(s) or lack of study drug. Even if these clinical trials are initiated, the Company cannot assure that the clinical studies will be successful or yield any useful data or require additional funding. Any forward-looking statements set forth herein speak only as of the date of this press release. The Company does not undertake to update any of these forward-looking statements to reflect events or circumstances that occur after the date hereof. The information found on our website is not incorporated by reference herein and is included for reference purposes only.

Contacts:
Crescendo Communications, LLC
Phone: 212-671-1021
Email: aim@crescendo-ir.com

AIM ImmunoTech Inc
Phone: 800-778-4042
Email: IR@aimimmuno.com

Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

Blue Orca’s Short Selling Plan Failed Because the Quality China Medical System (867.HK) Can Withstand Severe Tests

HONG KONG, Feb 14, 2020 – (ACN Newswire) – While the world attention is on the fight against Coronavirus in China, Blue Orca is concerned about other things at the same time. This time, this foreign short selling agency aimed at a high-quality Chinese pharmaceutical company.













According to Zhitongcaijing APP, recently, Blue Orca targeted China Medical System (867.HK), a well-known Chinese pharmaceutical company, by releasing a short selling report against the company on the morning of February 6, pointing out that this Chinese pharmaceutical company "is simply uninvestable".

Influenced by this report, the share price of China Medical System fell sharply by 12.7% from its peak at HK$ 10.72 to HK$ 9.36. However, due to the insufficient evidence of the allegations and the suspicion that Blue Orca had engaged in malicious short selling, a short selling report was not enough to shake investors' confidence in this high-quality company. The company's share price rebounded sharply after hitting the bottom of HK$ 9.35 at 11:03 a.m.. Moreover, before the suspension of trading, it rebounded by 9% to HK$ 10.2 in just 14 minutes at 11:17 a.m.

In recent years, it has been common for foreign short selling agencies to short sell Chinese companies, even for high-performing stocks such as BoSiDeng and ANTA Sports. In 2019, only Blue Orca itself has issued short selling reports against companies such as Kasen International, Ausnutria and NOVA Group.

However, by analyzing the market data on trading days before the release of Blue Orca's short selling report, Zhitongcaijing APP found that the short selling ratio of China Medical System had increased significantly, thus making this short selling incident worth pondering. Consequently, it's necessary for investors to rationally analyze this short selling report and correctly understand the intrinsic value of China Medical System.

Part 1 "Untenable" reasons for short selling
Short selling agencies commonly create notions of "guilt" at the beginning of their reports to guide investors decisions about a company regardless the authenticity of the evidence and data. Therefore, Blue Orca wrote "China Medical System is simply uninvestable" at the beginning of the report.

Next, the report listed four reasons why Blue Orca believed that the company had "fraud and corruption": 1. The company's filings in China indicated net profit was 49% less than the number reported in its annual report; 2. There were problems in Malaysia's tax benefit; 3. The company secretly funded the R&D expenses for chairman's private company; 4. Drug development pipeline: trading transactions between the company and the chairman.

For challenges raised by Blue Orca, investors are most concerned about the truth. Faced with the aggressiveness of Blue Orca, China Medical System promptly clarified and refuted the relevant charges. Investors can conclude from the company's announcement in response to the short selling report that the allegations made by Blue Orca were untenable. Zhitongcaijing APP also summarized the following information according to the company's reply.

Regarding the company's financial inflation: the business of Malaysia subsidiary actually exists.

Blue Orca doubted the existence of China Medical System's subsidiary in Malaysia and believed that China Medical System used its subsidiary's tax benefits to inflate its profits.

In fact, as an international pharmaceutical company, the business of China Medical System is divided into international business and domestic business. The international business section includes CMS Pharma (Malaysia) and Sky United Trading Limited, and the domestic business includes Shenzhen Kangzhe and Tianjin Kangzhe.

According to the clarification announcement of China Medical System, the company's international business functions are now mainly undertaken by its Malaysian subsidiary. These functions include: investment and introduction of new products, screening and evaluation of production plants, quality and supply chain management and control, the strategy formulation of macro promotion of products, and all risks related to the functions. The business and performance of the subsidiary really exist and enjoy local preferential tax policies. In addition, the company also stated that it has repeatedly discussed with professional tax consultants the issue of ensuring that the pricing of related transactions is reasonable and in line with the provisions of the domestic taxation bureau.

It's pretty simple to verify the authenticity of the company's performance, since the financial statements of China Medical System have continually been audited by one of the "Big Four" international accounting firms. Therefore, if there were inflated profits, Blue Orca would not have been the first to notice the problem.

In addition, to verify the company's profit, Zhitongcaijing APP reviewed its dividend payout in recent years. In recent years, the company has maintained a dividend payout ratio of 40%, with a dividend of RMB 729 million in 2018, accounting for 41% of the company's current free cash flow. This mainly thanks to the company's stable profitability. In light of this, if there was a large range of actual profit fluctuation, the company could not distribute such high dividends. The Blue Orca's allegation against China Medical System can also be refuted from this side.

China Medical System secretly funded research expenses for its chairman's private company and that the chairman then "resold intellectual property rights" to the company? False.

Taking advantage of information asymmetry to win the trust of investors has always been a common practice for short selling agencies, and Blue Orca made the most of it in this allegation.

Blue Orca devoted the biggest portion of its report to "struggle" with the industrial and commercial information of Kangzhe R&D and used it as evidence against China Medical System. This is exactly how they took advantage of information asymmetry.

As can be seen from China Medical System's clarification announcement, Kangzhe R&D does incur operating expenses, and thus chose not to disclose relevant information to the public when submitting operating expenses data to China's State Administration for Industry and Commerce (SAIC) in accordance with relevant regulations.

In addition, Blue Orca also cited a series of cases about companies such as Helius and Faron, so as to allege the chairman of China Medical System of using the resources of China Medical System for his personal gain, rather than participating in drug development.

The core of Blue Orca's allegation is that "the chairman [was] seeking personal gain," but if there was no such personal gain, this charge is meaningless.

In fact, none of the projects mentioned by Blue Orca being "suspected of reselling" required the company to pay down payments, the relevant payments for registration, sales milestone fees, or R&D expenses. Even though the projects, such as the Faron and Helius, were not finally approved, China Medical System did not bear any risks and costs.

According to the short selling report, it is clear that Blue Orca did not understand the practice of Lam Gang, the Chairman of China Medical System. After all, it is not in line with the "principle of a rational person" to bear the risks for the benefit of shareholders. This misunderstanding, however, is because Blue Orca does not understand what a "a doctor's sense of mission" entails.

In fact, some people, including Chairman Lam Gang, from the management were former doctors. Therefore, contrary to the allegations of Blue Orca, it is precisely that Lam Gang understands doctors and patients with the feelings of medical practitioners and hopes to introduce highly innovative, professional and clinically demanding drugs into Chinese market for the benefit of Chinese patients and families. Therefore, in the early stage of innovative drug investment, Lam Gang always bore higher risks himself. Furthermore, among early projects invested by him, NRL-1 (Diazepam Nasal Spray) has been approved for launch in the United States, and Helius project is also ready for application to the FDA again for marketing authorization. Therefore, it cannot be concluded that investments made by Lam Gang have all ended in failure.

In addition, in the context of the deepening of China's medical system reform and the increasing support for the development of innovative drugs, the company's development strategy has expanded from products that have already launched to the market to unlaunched innovative products in China. Therefore, the active arrangement of innovative drugs is pivotal to the rational transformation and upgrading of pharmaceutical enterprises, which is in stark contrast to the "misleading development" mentioned in Blue Orca's report.

In conclusion, the allegation of Blue Orca against China Medical System was insufficient in both the viewpoint and the proof, so it could hardly function as a rigorous short selling report, thus not worthy of investors' reference.

However, the purpose of Blue Orca may not be simply issuing a short selling report that was not rigorous.

Part 2: A premeditated "short selling operation"
It is worth our attention to consider that agencies issue short selling reports for their own profits rather than for those of the investors.

In the 41 pages extensive short selling report, Blue Orca had to mention in the disclaimer that "we will make money if the price of China Medical System stock declines." This is a common trick of short selling agencies: issuing short selling reports, triggering panic sales by investors, and then leaving after quickly making a large amount of money.

The data presented by the Zhitongcaijing APP clearly showed that from December last year to January 7 this year, the historical average short selling ratio of the company remained around 5%, with a minimum of only 0.17%, and the amount of short selling totaled only HK$ 22,200. This normal short selling reflects investors' bullish sentiment towards China Medical System.

However, on January 9, the company's short selling ratio suddenly rose to 53.62%, with an amount of HK$ 70,929,600. In the following month, the company's short selling ratio mostly fluctuated between 10-30%.

On February 3, before the report was released, the company's short selling ratio rose sharply to 38.32%, with amount of HK$ 50,866,700. In the next three days, while the ratio decreased, it still remained over 30%. Therefore, combined with Blue Orca's report and the short selling performance of the market, we cannot rule out that this was a "planned" short selling operation.

But for investors, it is also a good time to buy when the stock price of a company that suffered from short selling fluctuates. If investors want to make profits after this short selling incident, they need to have a clear understanding of the intrinsic value of China Medical System.

Part 3: Investment opportunities: when undervalued companies are sold short
To invest in a mature and innovative pharmaceutical company in the Hong Kong stock market, there are two core elements of value judgment: business with stable cash flow and reasonable arrangement of innovative drugs.

Investors need to start from these two core elements to understand the foundation of stable valuation of the company, and its development potential behind the rich pipeline of innovative drugs. These are also the core logic from which investors analyze the internal value of China Medical System.

Since IPO, the steady performance of the company has always been a highlight attracting investors.

According to Zhitongcaijing APP, China Medical System has been maintaining a high-speed revenue growth since it was listed on the main board of Hong Kong Stock Exchange in 2010. By the end of 2018, the company's turnover excluding the effects of two-invoice system reached RMB 6.135 billion, with CAGR of 28.1% in the past 10 years and the CAGR of the company's net profit reached 32.9% in the same period.

In terms of key financial indicators, the return on equity (ROE) of the company has remained above 20% since 2010; in 2018, the dividend yield of the company reached 4.9%.

In recent years, with the deepening of national pharmaceutical reform, the pharmaceutical industry has gradually entered a stage of comprehensive adjustment. The reason why China Medical System could maintain steady performance growth throughout the changing policy context was that the policy has few impacts on the company.

In the period of "two-invoice system," since "the first invoice can be directly given to a national exclusive agent of imported drugs since it can be treated as the original manufacture," China Medical System is regarded as a standard "two-invoice system enterprise," which means it is not subject to two-invoice system basically. Since 2017, the two-invoice system policy has been implemented in China, and China Medical System's performance growth tended to be stable. The company's revenue excluding the effects of two-invoice system increased by 14% and 10% in 2017 and 2018 respectively, and by 14% in the first half of 2019.

Moreover, in 2019, the supply side related policy, which "expand the scope of centralized procurement" with "price reduction", had minor impact on China Medical System in the short term. It is worth noting that the majority of nine major products, which account for more than 90% of the company's total revenue, are exclusive products, meaning they face no competition from generics. Only Plendil and Deanxit may be affected. However, currently in domestic market, none of the domestic generics for Plendil has passed the consistency evaluation while only one competing generic has passed for Deanxit. Based on the product selection rules of "there shall be three or more generic drugs to pass consistency evaluation" in the third round of centralized procurement, the impact of centralized procurement on Plendil and Deanxit will be delayed. This is undoubtedly good news for China Medical System as it is actively making arrangement of new products.

The ability to avoid risks and stabilize performance growth in the changing "deepening area" of pharmaceutical reform fully demonstrates that China Medical System has a strong capability to judge industry trends and make development plans.

While vigorously developing its existing business, China Medical System is actively making arrangement of innovative drugs and generics with sufficient market competitiveness.

As a pharmaceutical company with international development ability, China Medical System is moving towards another important path to meet huge unmet medical needs with its excellent drug searching ability and the integration of international resources to cultivate its innovative drugs pipelines. Up to now, the pipeline of China Medical System includes 19 innovative drugs in various fields including ophthalmology, dermatology, nervous system, anti-tumor, immune system, digestive system, anti-infection and endocrine system. Six of the products have been approved for launching overseas, one is under the FDA's review process, and the other five products have entered the phase III clinical trial stage. With this arrangement, China Medical System will be able to constantly launch innovative products to the market in the short, medium and long terms.

A number of innovative products that either have been launched in the Europe and the United States or prepared for marketing application are as follows:

Name / Indication / Overseas Registration / Market Potential
ILUMYA(Tildrakizumab) / Moderate to severe plaque psoriasis / Approved for marketing in the U.S. / RMB5-6 billion
CEQUA(Cyclosporin A Ophthalmic Solution) / Increasing tear production in patients with dry eyes / Approved for marketing in the U.S. / About RMB3 billion
NRL-1(Diazepam Nasal Spray) / Patients of 6 years of age and older with acute repetitive seizures /
Approved for marketing in the U.S. / Over RMB3 billion
Taclantis(Paclitaxel Injection Concentrate for Suspension) / Metastatic breast cancer, locally advanced or metastatic non-small cell lung cancer and metastatic adenocarcinoma of the pancreas / NDA submitted to the FDA / Over RMB3 billion

According to Zhitongcaijing APP, the main advantages of Tildrakizumab are to provide psoriasis patients with the most cost-effective option, a novel monoclonal antibody drug specifically targeting IL-23, as well as to reduce patients' pain with less injection times. Its market potential can reach RMB5-6 billion.

The main advantages of Cyclosporin A Ophthalmic Solution are: it's the globally first cyclosporine ophthalmic eye drops, which is clear and preservative-free, and adopted Nanometer miceller formulation technology to improve in tissue. Its market potential can reach about RMB3 billion.

The important advantages of NRL-1 (Diazepam Nasal Spray) is that it's convenient to use at home as it quickly takes effect for the treatment of acute and repetitive seizures. Its potential market potential can reach over RMB3 billion.

The important advantages of Paclitaxel Suspension Injection Concentrate are: Cremophor and albuimin-free, one-step dilution and no premedication. Its market potential can reach over RMB3 billion.

Combined with the company's academic promotion ability, both revenue and profits of the company will be greatly increased after these blockbuster drugs are approved for marketing in China.

In China, there is a huge market demand for imported generics with proven quality and affordable prices. Therefore, while actively making arrangement of innovative drugs, China Medical System is also making arrangement of generics clusters with high market competitiveness.

According to Zhitongcaijing APP, China Medical System's development strategy for generics is to establish strategic cooperation with the global leading pharmaceutical companies via the light assets mode, so as to make arrangement of generic drug clusters with high market competitiveness.

In August 2019, China Medical System announced that it signed in-licensing agreements with Sun Pharma to acquire seven generic products and one highly competitive complex generic drug. In September of the same year, the company signed an in-licensing agreement with Biocon for three generics. If these drugs enter the Chinese market in the future and participate in centralized procurement, they will create a huge incremental market for the company.

As a well-known pharmaceutical company in China, enjoying a nationwide sales network guarantees the stable valuation of China Medical System.

Data shows that the number of hospitals covered by direct network of the company increased from 17,000 in 2014 to 57,000 in the first half of 2019. The network fully covered all provincial-level and the majority of prefecture-level districts, and almost covered all class III & class II hospitals as well as the major therapeutic departments of class III hospitals in China.

It is worth noting that China Medical System has adopted the academic promotion with line division mode which is similar to international pharmaceutical companies. From 2013 to 2018, selling expense ratio of China Medical System remained below 23%. After excluding the effects "two-invoice system" in 2018, the selling expense ratio was only 22.4%, even lower than the standard of selling expense ratio of international pharmaceutical companies.

These data indicated that China Medical System has strong capabilities of marketing and product commercialization, which can certainly provide strong support for its commercialization of innovative products in the future.

However, it has been undervalued by the market for a long time.

Zhitongcaijing APP observed that as of the close of trading on February 7, the share price of China Medical System was HK$ 10.2 and PE (TTM) was 10.99. Compared with the company's valuation data in the past three years, it is easy to see that the present share price of China Medical System has been far away from the median of the valuation, and obviously been undervalued. In addition, as mentioned above, the dividend yield of the company in 2018 reached as high as 4.9%, which gives another proof that the company has a high investment value based on its attractive valuation, and its reliable performance growth.

Just as a Chinese idiom "pure gold fears no fire", the turnover of China Medical System achieved the stable growth and the key financial indicators maintained reliable. In addition, the company also possessed the strong risk resisting capabilities at a time of pharmaceutical reform in China, and the strong strength and sustainable development driving force in the development of the specific business and innovation deployment. With these capabilities, the company does not fear malicious provocation by short selling agencies. At present, China Medical System stands at a status of serious undervaluation, which is a rare target with low valuation in the pharmaceutical sector of the stock market in Hong Kong. If investors can seize this opportunity, they will surely receive rich investment returns as the business performance is continually growing and the pipelines of innovative drugs are gradually launching to the market.

By Zhitongcaijing





Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

China Medical System (867.HK) Armed against Short Selling! The Biggest CSO Took Control of Full Industrial Chain

HONG KONG, Feb 14, 2020 – (ACN Newswire) – The short-selling company Blue Orca Capital would not have expected that its confrontation with China Medical System Holdings Limited ("China Medical System") actually helped the company. The confrontation allowed investors and the whole pharmaceutical industry in China to see the biggest CSO has quietly reached the end of its transformation into a new empire that has established full control over an industrial chain, from sales and marketing to production and quality, and has jumped from the domestic market to a company driven by global R&D innovative resources.

By reviewing the seemingly detailed report from Blue Orca Capital ("Orca") and a brief but solid response from China Medical System issued on 7th February, as well as an interview with Mr. Lam Kong, Chairman of the board of China Medical System, Healthcare Executive tried to review the path of China Medical System's most essential product upgrading experience, especially the globalized market and operation capacity of R&D resources from its large overseas companies groups, which was disclosed to the public for the first time. Throughout its development in the recent decade, China Medical System, as a leading CSO, has been revolutionizing itself since it was listed on the stock exchange. The journey of detaching itself from CSO and marching into the full industrial chain was full of tensions and challenges.

01. Malicious digging exposed a brand-new China Medical System
On the morning of 6th February, Orca released a 41-page short selling report against China Medical System. The report indicated that the profitability of China Medical System was fictitious and the actual net profit was 49% lower than the reported number. It also raised doubts that China Medical System was involved in private deals and corruption.

At 11:17 a.m. on that same day, China Medical System called for an immediate suspension in the stock market, which did not prevent a slump in its stock price of 12.7% in just 9 minutes. However, the price soon bounced back by 9% in the next 14 minutes. The closing price before the suspension was only 1.9% lower than that of the previous day. Despite the rollercoaster, the overall price still remained stable compared to that of companies involved in other short selling cases.

Companies listed in the Hong Kong Stock Exchange are regularly targeted by short sellers and these incidents have been growing more frequently since 2019. Orca has already attacked Pinduoduo, ANTA Sports and Kasen in the past year but these companies' stock prices all surged after they resumed trading. ANTA, in particular, short sellers were frustrated when Anta's share price hit a record high after rounds of short selling. Generally, companies pinned by the short sellers usually have much higher profit margin or much lower costs than that of their peer companies, or they have high continuous growth rate or burn rate. In the pharmaceutical industry, the short sellers once targeted Genscript, the parent company of Nanjing Legend, and BeiGene, which were both investing high in R&D and bearing high risks.

China Medical System was also in a key stage of transformation and the company has thus far proceeded with a stable operation and good profit margin. On the night of 7th February, China Medical System made a clarification announcement, providing responses to all Orca allegations, concluding that these allegations were "groundless and seriously misleading".

Healthcare Executive quickly reached out to Mr. Lam Kong, the Chairman of the Board of China Medical System and set up an interview. Surprisingly, this company with relatively low profile decided to disclose an unprecedented amount of details, many of which were revealed for the first time. The abundant evidence provided by China Medical System not only crushed any allegation made by the short sellers, but also indicated that after many years of strategic transformation, a new China Medical System was appearing and that this new China Medical System had new ambitions and aspirations.

Throughout the company's history, China Medical System was referred to as "the leading CSO". But what is a CSO? It allows pharmaceutical promotion and sales activities based on powerful pharmaceutical promotion capacity and network coverage. Lam Kong barely explained the title, but it was clear that the association of CSO with China Medical System has obscured the development logic of the company over the past few years. This was the first time Mr. Lam Kong shared the innovative development of China Medical System with the public and unveiled the global competitiveness of China Medical System hidden under the "iceberg" of pharmaceutical marketing services.

02. The strongest fightback: up to 40% dividend for 10 consecutive years
Orca asserted that China Medical System overwhelmingly exaggerated its financial performance with an inflated profit of 49%. China Medical System replied in the "Clarification Announcement" that the company has maintained a constant 40% dividend payout ratio with its continued investment and low debt status since it was listed. It would be impossible for the company to realize such a high payout rate if the reported 49% profit were false.

China Medical System landed on Hong Kong's capital market in 2010. According to the financial reports, from 2010 to 2018, the company's annual profit rose from RMB 206 million to RMB 1,844 million, a compound annual growth rate of 32.9%. Throughout the decade, the company maintained a payout ratio of 40% of the net profit, with the accumulated dividend of RMB 3.08 billion.

"It was like I earned 100 yuan, to which you said 49% of what I earned never existed, and that in actuality I only ever earned 51 yuan. Then, from that 51 yuan, I paid 40 yuan to the stakeholders as dividend. My question to you would then be, do you really think China Medical System is that foolish? How would it be possible to run the company and complete investments with the remaining 11 yuan? Why would I do this?", said Lam Kong.

In fact, the cash flow and the gearing ratio of China Medical System have both been maintained at a good level. According to the previous financial reports, only the gearing ratio in 2016 and 2017 reached 16.5% and 20.7% while those in other years stayed below 15%. Through these periods, China Medical System was buying products. In particular, in 2016, it spent $310 million on the commercialization right of AstraZeneca's exclusive product Plendil in China, which has become a classic case in the industry. As Lam Kong put it, "High payout ratio, low gearing ratio, and abundant cash cooperation cases overseas, these are enough to prove the profitability of China Medical System".

From the short selling report, one of the major reasons behind the allegation of inflated profit was, "China launched the Centralized Procurement of Drugs with targeted volume in 2018. The policy directly forces down the price and weakens the value of marketing network. The profits of other agents all decreased while China Medical System's profitability was still reported to be promising with continuous growth, which was very confusing."

This type of "presumed-guilty argument" is absurd. Based on Healthcare Executive's observation of the industry, the pharmaceutical industry in China is undergoing a drastic change. Although price-reducing policies like centralized procurement of drugs squeezed the profit of mature original drugs and generic drugs, the innovation encouraging and medical insurance policies are stimulating industrial growth. In the past year, multinational pharmaceutical companies with innovative drugs like Merck, Roche and AstraZeneca have undergone unprecedented growth. The sales of drugs that have not been listed in the centralized procurement are still increasing. By the advantages of its products, China Medical System is clearly more similar to multinational pharmaceutical companies.

So far, the products that contribute the major profits of China Medical System have not been affected by the centralized procurement. According to the upgraded procurement policy, it only applies to the products with at least one original and no less than two generics. Among the major products that China Medical System promotes and sells, Deanxit is the only product for which there is one generic competitor that has passed consistency evaluation. No other product has so far been affected. This also shows how unique and forward-looking the company is in its choice-making regarding products selection. It is expected that in the following 1 to 2 years, the products of China Medical System will not be listed in the centralized procurement.

Orca also reported that China started the two-invoice system in 2017, which directly affected China Medical System which lies between the manufacturers and agents and that the company's position in this value chain was significantly challenged. But in fact, the two-invoice policy indicates that the national exclusive agents of imported drugs are deemed as manufacturers. The imported drugs, self-produced products and the products produced by the subsidiaries of the China Medical System would not be affected. For some non-self-produced products, the only difference is changing from low ex-price to high, which only affects the way of financial recording but not the profit. The allegation made by Orca not only seems too general, but also reflects its lack of knowledge about the pharmaceutical industry.

03. Products upgrade reflects an "alternative" path of R&D
After the release of Orca's report, the three cases of overseas innovative drug investment, though little attention was paid to them previously, also came into public notice. This allowed the public to understand how China Medical System introduces products and the logic it employs regarding product upgrade and iteration.

Lam Kong explained that China Medical System is taking an "alternative" path of innovative drug R&D. It is defined as "alternative" because the common R&D path for pharmaceutical companies is simply R&D (research and development) but China Medical System is taking the path of S&D (search and development). China Medical System is enriching the product lines of innovative drugs by seeking high-quality innovative drug projects worldwide and participating in the early-stage research and development. In fact, in the recent two years, this pattern has been adopted by more and more companies for innovative drugs. China Medical System, on the other hand, has been pursuing this method of development for a considerable period of time.

The three "corruptive deals" raised by Orca were the products deals with three startup R&D companies, Helius, Faron and Neurelis, which Orca revealed all ended in failure.

China Medical System replied that the company's requirement for its products is in global perspectives, to meet the clinical needs. It is well-known that this kind of products possess relatively high R&D risks in the early stages. The listed company is usually very cautious about this kind of investments due to concerns of stability. Therefore, as the major stakeholder of China Medical System, Lam Kong spent his own money to pay upfront for purchasing these products. And he also undertook the risks of investment failure. Lam Kong would not transfer the product (including the intellectual property and sales rights) to China Medical System until the product had achieved substantial progress. Lam Kong even joked that it was really rare to see such a good stakeholder being so loyal to the company, personally taking responsibility for all of the risks while giving all of the benefits to the listed company.

Besides, these investment cases are not exactly the "disastrous investment" described in the short selling report. In 2015, when Lam Kong was investing in Neurelis, the drug had not yet reached the clinical stage and was highly uncertain. As China Medical System announced on 13th January 2020, the U.S. FDA has approved Neurelis' diazepam nasal spray for marketing in the U.S. market by epileptic patients of 6 years of age and older, who suffer from intermittent and stereotypic epileptic seizures. This product has recently received the clinical trial notice from NMPA. After five long years of tireless efforts, Lam Kong had achieved his first overseas investment success.

It is clear that Lam Kong had already made attempts in introducing R&D innovative products overseas while the company remained focused on the sale and promotion of drugs in 2015. His vision and strategic pace were a step ahead of the industrial development. According to him, the transformation of China Medical System started as early as 2013.

In February 2013, China Medical System had already acquired the exclusive sales rights for at least 9 products including Deanxit, Ursotalk, Ganfule, Stulln and Xinhuosu. By then, Lam Kong noticed that the market for Ganfule, a product treating liver cancer, was constrained by upstream manufacturers. To make a comprehensive market plan for Ganfule, China Medical System spent RMB 81.10 million acquiring the manufacturing plant of Ganfule, Lengshuijiao Pharmaceuticals, and thereby obtained full control of the product. Since then, the company has continued to pursue product rights, including those for Lamisil, Parlodel, MOVICOL, Combizym, Hirudoid, Stulln and DanShenTong. The company even started a war with Tibet Pharmaceuticals for the controlling rights of Xinhuosu, eventually bringing this product into its product line as well.

From then on, China Medical System has gradually introduced a pattern of introducing products covering exclusive sales rights, rights control, equity cooperation and self-production, enabling the company to gain more and more control over the product. This has become known as the "China Medical System pattern" within the industry. This pattern was best exemplified when the company bought Plendil from AstraZeneca in 2016, proving that China Medical System had established a deep cooperation with major multinational companies.

Since 2015, Lam Kong has noticed the innovative trend in the Chinese pharmaceutical market and got down to the business of introducing innovative drugs, which opened the second stage of the transformation. This process was conducted by the personal and stakeholder investment, like the Neurelis project mentioned above.

In 2017, as the overseas business development team was growing mature, considering the high risks of on-going R&D drugs, Lam Kong and China Medical System each handled half through equity investment. Once the investment succeeded, China Medical System could obtain 100% of the drug's rights and take over the global R&D resource and talent resources. According to the annual report, in 2018, China Medical System strategically invested in several R&D companies from the U.K., France, Switzerland and America and acquired the rights of 5 major innovative drugs in China and part of Asia-Pacific markets. The company also purchased the exclusive rights of two products in China from an Israel biopharma company.

In 2019, the centralized procurement policy was released and quickly spread. Though China Medical System' products were not yet affected, Lam Kong still expected to increase the pace of business innovation and introduce more good quality products to the Chinese market. China Medical System started to purchase some products approved by the FDA but not yet launched in China. For example, it bought the exclusive licensing rights of two innovative drugs and five generic drugs from Sun Pharma in India and signed another contract with Sun Pharma for the licensing rights of five innovative drugs including Paclitaxel injection concentrate in November.

This is the strategic map of the acquisition journey China Medical System has followed. It is also a history of how its products structure has evolved in response to changes in relevant policies. By investing in the overseas innovative R&D companies, China Medical System was also able to arrange its resources for global innovative research institutes and talents while also extending its business to cover the full medical industrial chain including R&D, production and marketing. Starting from a CSO company, China Medical System has been detaching itself from CSO and transforming to a "well-established, innovation-driven specialty pharma with a focus on sales & marketing in China."

To Lam Kong, the logic is very simple, "The purpose of research is for the products, rather than the research itself. There are many ways to meet the unmet clinical needs and get the valuable drugs. Overseas business development is also a capability." Driven by the innovation and the policy of centralized procurement, China Medical System has always been leading the way in the development of the pharmaceutical industry under tight regulations. Making preparations before everything becomes apparent makes a wise man.

04. Under the iceberg: establish a global industrial chain system
Over the past half month, China Medical System spent the busiest Spring Festival ever with its global partners. After the outbreak of the new coronavirus, China Medical System immediately called upon its global partners and purchased 200,000 N95 masks and 50,000 children masks from overseas. The supplies were transported and successfully passed through customs thanks to its global business supply chain. With its digital marketing platform, 20,000 N95 masks were delivered to 10,000 doctors in just one day.

China Medical System's global supply chain system is currently demonstrating its power. In such an urgent time, there are surely not many companies that are able to personally distribute global supplies to the hands of doctors.

"Many only see our CSO businesses in China, but that is just a tip of the iceberg. Like an iceberg, a major part of our businesses, like our capability for global arrangement and the control of a full industrial chain, is actually located "under" the visible plane", said Lam Kong. He also commented that those who are engaged in the overseas business development all know that buying drugs overseas is not simply about "buying." Besides overseas MAH conversion, reselection of manufacturing factories, re-control of the factory quality and so on, the understanding of overseas business cultures and law systems directly affects the success and efficiency of the negotiation. Quality management, production management and control management, as well the entire global logistics supply chain, present big challenges to a company's capabilities.

For example, Lamisil that China Medical System introduced from Novartis in 2014 has completed the localization and now is produced by China Medical System in its production site in Hunan. The localization covers a series of complicated procedures including MAH conversion.

"What the public knows about China Medical System is only our CSO businesses in China. But the whole China Medical System group also includes the global industrial chain formed by our overseas groups, like those in Malaysia. The entirety of China Medical System is not a CSO company", said Lam Kong.

According to the interim report of 2019, by 30th June 2019, China Medical System had owned 13 innovative products in the fields of ophthalmology, dermatology, neurology, oncology, immunology, gastroenterology, anti-infection and endocrinology. Some of products have acquired marketing authorization from the FDA, EMA and Health Canada, respectively. The domestic R&D, development and sales of these products are also underway.

Products are the soul of pharmaceutical companies. A portfolio of products with differentiated advantage is the most important factor for a pharmaceutical company to become a global innovative one. Driven by policy and technology, the Chinese pharmaceutical industry is undergoing a great, game-changing transformation and upgrade. The industrial development focus on the clinical needs and the transformation will be no less than an earthquake in the industry before it is done.

Hardship brings success. Leading the transformation along with a decade of deployment, this new iteration of China Medical System is thriving. When a brand new China Medical System appears in the Chinese medical industry, the biggest inspiration is its inner logic and path: one is to develop innovative products that could offer Chinese patients new treatment solutions through a global vision, and the other is to deepen the national academic network to consolidate the academic differentiation of the current products.

By Yong Tan and Xinyuan Yang of Healthcare Executive



Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

Hua Medicine appoints Dr. Fuxing Tang, a former U.S. FDA Officer, as Chief Technology Officer

SHANGHAI, Feb 14, 2020 – (ACN Newswire) – Hua Medicine, a leading clinical stage biotechnology company based in Shanghai, is pleased to announce that Dr. Fuxing Tang has joined Hua Medicine as Chief Technology Officer, VP of Formulation R&D and Product Development. He will also head up research and development functions for Hua Medicine in the United States.

Dr. Fuxing Tang obtained his Ph.D. in Pharmaceutical Sciences from the University of Florida. In addition, Dr. Tang conducted postdoctoral research in peptide delivery in Professor Ronald Borchardt's group, which is well known for their work in Caco-2 cells. Before joining Hua Medicine, Dr. Tang worked in the pharmaceutical industry and regulatory affairs for 20 years. Dr. Tang worked as reviewer in the Office of Regulatory Science of the U.S. Food and Drug Administration, and worked in TEVA and Allergan as Global Director of Biopharmaceutical Sciences. Dr. Tang started his career at Forest labs, Inc. During his tenure at Forest labs, Inc/Allergan, Dr. Tang was instrumental in building various biopharmaceutical functions and in charge of multi-functions of ADME, preformulation, drug product process optimization and product post-approval manufacture process optimization.

Dr. Tang and his team made significant contributions in multiple successful IND/NDA filings and supported post-approval manufacturing for drug products such as Lexapro, Namenda, Namzaric, Linezess, Vraylar, Viberzi, among others, of which Lexapro, Namenda are blockbuster products with peak annual sales of US$2 billion. At Allergan/TEVA, Dr. Tang and his team supported drug development for both NDA and ANDA. Dr. Tang and his team significantly contributed to multiple first-to-files ANDA approvals such as doxycycline and abuse-deterrent-formulation (ADF) morphine sulfate.

Dr. Tang authored/coauthored more than 20 peer-reviewed research articles/patents across various fields, including organic synthesis, gene delivery, pre-formulation, formulation, and ADME studies.

"We are very excited to welcome Dr. Tang to join the Hua team, leading and accelerating new products development based on our glucokinase platform." said Dr. Li Chen, CEO of Hua Medicine. "Dr. Tang is highly experienced in a broad range of drug discovery and development, and contributed to many important innovative and generic drug developments. He will help Hua Medicine expand dorzagliatin product pipeline globally and our engagement in R&D innovation in the United States."

"I'm very excited to join Hua Medicine, a leading biotech company not only developing innovative medicine for patients worldwide, but also providing leadership in creating ecosystem in pharma R&D in China. By successfully developing dorzagliatin as a global First-in-Class diabetes medicine in China, Hua Medicine has greatly advanced the concept of "fix the sensor and remodel the glucose homeostasis" to treat diabetes," said Dr. Tang. "It offers tremendous opportunity to expand its indications and production pipeline through innovation in the pharmaceutical sciences which will help many patients worldwide."

Hua Medicine announced in November 2019 that the 24-week top-line results from its Phase III Monotherapy Trial (HMM0301) of HMS5552 (dorzagliatin) achieved its primary efficacy endpoint with desirable safety profiles. As HMM0301 will soon be completing its 52-week study, and Phase III Combination Trial (HMM0302) of HMS5552 add on to metformin is near completion of its 24-week study, Hua Medicine is expanding its pipeline into multiple combinations of dorzagliatin with existing oral and injectable anti-diabetic medicines. These efforts will significantly increase the value of dorzagliatin as a novel cornerstone therapy to stop diabetes and its complications.

About Dorzagliatin

Dorzagliatin is a first-in-class, dual-acting glucokinase activator, designed to control the progressive degenerative nature of diabetes by restoring glucose homeostasis in people with type 2 diabetes. By addressing the defect of the glucose sensor function of glucokinase, dorzagliatin has the potential to restore the impaired glucose homeostasis state of people with type 2 diabetes and serve as a first-line standard-of-care therapy for the treatment of the disease, or as a cornerstone therapy when taken in combination with currently approved anti-diabetes drugs.

About Hua Medicine

Hua is a leading, clinical-stage innovative drug development company in China focused on developing novel therapies for the treatment of diabetes. Founded by an experienced group of entrepreneurs and international investment firms, Hua advanced a first-in-class oral drug for the treatment of type 2 diabetes into NDA-enabling stage and is currently evaluating the therapy in adults with diabetes in two Phase III trials in China and various earlier stage clinical trials in China and the United States. Dorzagliatin has achieved its first primary endpoint in a Phase III monotherapy trial. The company has also initiated product life-cycle management studies of this novel diabetes therapy and advanced its use in personalized diabetes care. Hua Medicine is working closely with disease experts and regulatory agencies in China and across the world to advance diabetes care solutions for patients worldwide.


Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com

Aptorum Group Announces Further Positive Data For Its ALS-4 Small Molecule Anti-virulence (Non-bactericidal) Drug Candidate For The Treatment of Infections Caused By Staphylococcus Aureus and On Track Targeted For IND Submission in H2 2020

HONG KONG, Feb 11, 2020 – (ACN Newswire) – Aptorum Group Limited (NASDAQ: APM) ("Aptorum Group"), a biopharmaceutical company focused on the development of novel therapeutics to address global unmet medical needs, announces further positive data from its current investigational new drug (IND)-enabling studies for ALS-4, a small drug molecule candidate indicated for the treatment of infections caused by Staphylococcus aureus (or "S. aureus"), including methicillin-resistant Staphylococcus aureus (MRSA, one of the "super-bugs"), based on a novel anti-virulence non-bactericidal approach. Subject to completion of the current studies, Aptorum Group targets to submit IND for ALS-4 in second half of 2020 and commence a phase 1 trial in North America.

ALS-4 is a small molecule which inhibits dehydrosqualene desaturase of S. aureus (incl. MRSA), an enzyme that is critically involved in the biosynthesis of staphyloxanthin, a commonly visible "golden pigment" covering the bacteria. Staphyloxanthin is believed to be primarily responsible for the bacteria's defense mechanism against the attack from reactive oxygen species (ROS) deployed by phagocytic cells and neutrophils.1

Through inhibiting the production of staphyloxanthin, we believe that ALS-4 renders S. aureus highly susceptible to the host's immune defense (see below for in vivo data and experimental outline). This novel mechanism is significantly different from the bactericidal approach found in currently marketed antibiotics used to treat S. aureus, which are experiencing increasing drug resistance issues2. Specifically, MRSA infections in humans typically exhibit high rates of morbidity and mortality and can cause metastatic or complicated infections such as infective endocarditis or sepsis, with relapse and hospital readmission after S. aureus bacteremia common and costly3.
Based on our testing in a rat bacteremia survival model, a lethal (109 CFU) dose of MRSA (USA300-LAC) was introduced through the tail vein. ALS-4 was administered orally at 10mg/kg per animal 30 minutes after the infection for twice a day thereafter (N=9). A control untreated group was given a sterile vehicle solution (N=9). Survival was monitored for 7 days. 0 out of 9 animals (0%) in the control untreated group survived past day 4, in contrast, 5 out of 9 animals (56%) treated with ALS-4 survived past day 7, which is determined to be statistically significant compared with the control group (p=0.013).

In addition we conducted a study in a non-lethal rat bacteremia infection model. The animals were challenged with a non-lethal (107 CFU) dose of MRSA (USA300-LAC) through the tail vein. In order to simulate a more realistic clinical scenario, treatment was introduced 14-days after the model induction, where ALS-4 was administered orally twice a day at 10mg/kg per animal (N=8). A control untreated group was given a sterile vehicle solution (N=8). After 7 days of ALS-4 treatment, the kidneys were collected and the bacterial titers were measured. Remarkably, ALS-4 reduced the organ bacterial load by 99.5%, from 63,096 plus-minus 18 CFU/g in the control group to 316 plus-minus 49 CFU/g in the ALS-4 treated group, which is determined to be statistically significant (p=0.01).

Last but not least, ALS-4 has successfully inhibited staphyloxanthin production in 11 strains of S. aureus. These include 5 strains of Methicillin-sensitive S. aureus (MSSA): SH1000, HG003, USA300-JE2, Newman, and ATCC29213 with an IC50 of 70.5 plus-minus 6nM, 54.4 plus-minus 4nM, 37.7 plus-minus 4nM, 23.7 plus-minus 1nM, and 30.02 plus-minus 5nM respectively; 5 strains of Methicillin-resistant S. aureus (MRSA): USA300, USA300-3, USA300-LAC, ST239III, and COL, with an IC50 of 30.8 plus-minus 5nM, 42.8 plus-minus 6nM, 43.6 plus-minus 5nM, 16.3 plus-minus 8nM, and 0.9 plus-minus 1nM respectively; and 1 strain of vancomycin-intermediate S. aureus (VISA), Mu3 with an IC50 of 2.6 plus-minus 1nM.

Based on our testing, we believe ALS-4 increases the susceptibility of S. aureus including MRSA to oxidative damage by inhibiting production of staphyloxanthin,. In a hydrogen peroxide killing assay, after the addition of 1.5% H2O2, ALS-4 demonstrated an additional reduction of bacterial CFU by 93.5%, from 61,600 plus-minus 6437 CFU/ml in the untreated group to 4,000 plus-minus 230 CFU/ml in the ALS-4 treated group, which is determined to be statistically significant (p=0.003).

With respect to the study carried out to investigate the capability of ALS-4 to induce antibiotic resistance in S. aureus after prolonged exposure, USA300-LAC was cultured in 3 different conditions for 10 days. For the treatment group 1 micromolar of ALS-4 was added; for the positive control group 0.12 microgram/mL of clindamycin and 16 microgram/mL of erythromycin was added from day 1 to day 4, after which clindamycin was withdrawn. For the negative control group, dimethyl sulfoxide (DMSO) was added. On day 11, the bacteria were harvested and then cultured for 16 hr for the determination of the MIC of clindamycin. The prolonged exposure to ALS-4 or DMSO does not affect the MIC value of clindamycin (0.12 microgram/mL); while the prolonged exposure to clindamycin + erythromycin triggers antibiotics resistance rapidly with the MIC increased from 0.12 microgram/mL to greater than 5 microgram/mL.

Based on our study we believe ALS-4 is unlikely to be prone to drug resistance since it is non-bactericidal. Growth inhibition studies were performed on different strains of S. aureus and other bacteria, including 3 strains of MSSA (ATCC29212, SH1000 and HG003), 1 strain of MRSA (USA300), 1 strain of VISA (ATCC700698 Mu3), as well as 6 different bacteria (E. coli, A. baumannii, S. cerevisiae, B. subtilis, E. faecalis, and K. pneumoniae). In all of the tested strains of bacteria, no growth inhibition effect was observed at the highest tested concentration of ALS-4 (250uM). Therefore ALS-4 does not appear to have any direct bacteriostatic or bactericidal activity against many species of bacteria, thus greatly reducing the selection pressure for drug resistance to emerge.

We also assessed the potential impact on the efficacy of vancomycin, the mainstay of treatment for infections caused by MRSA, when used in conjunction with ALS-4. 8 different strains of S. aureus (USA300 FPR3757, USA300-3, USA300-LAC, USA300-JE2, Mu3, HG003, ATCC29213 and clinical isolate ST239III) were used in this study. Our data showed that no effect on the MIC of vancomycin was observed when the concentration of ALS-4 was below 25 microgram/mL. Therefore, we believe that ALS-4 does not interfere with the action of vancomycin.

In addition, compared with the current mainstay of treatment for S. aureus infections such as vancomycin or daptomycin which is typically administered in an IV injectable form (with the exception of an oral form vancomycin specifically for treatment of Clostridium difficile diarrhea and staphylococcal enterocolitis only), an oral active agent enables wider market penetration targeting both outpatient as well as potential prophylactic markets.

GLP Toxicity Data
ALS-4 is currently undergoing IND-enabling studies and has so far shown positive safety profiles. As elucidated in our previous press release dated September 9, 2019, ALS-4 did not show any mutagenicity in the in vitro Ames tests. Our currently generated in vitro micronucleus test results also showed that ALS-4 is not genotoxic, indicating the non-mutagenic nature of the drug. Furthermore, the results of the in vitro hERG assay study predicts a low risk of ALS-4 causing cardiac QT prolongation.

For further general presentation, please visit: http://ir.aptorumgroup.com/static-files/bcf77574-7bd6-4b9d-8110-d53837238f16

For further technical presentation, please visit: http://ir.aptorumgroup.com/static-files/66346f79-7a03-474a-89be-0eaafaa00d9d

About Aptorum Group Limited
Aptorum Group Limited (Nasdaq: APM) is a pharmaceutical company dedicated to developing and commercializing novel therapeutics to tackle unmet medical needs. Aptorum Group is pursuing therapeutic projects in orphan diseases, infectious diseases, metabolic diseases and other disease areas.

For more information about Aptorum Group, please visit www.aptorumgroup.com.

Disclaimer and Forward-Looking Statements
This press release includes statements concerning Aptorum Group Limited and its future expectations, plans and prospects that constitute "forward-looking statements" within the meaning of the Private Securities Litigation Reform Act of 1995. For this purpose, any statements contained herein that are not statements of historical fact may be deemed to be forward-looking statements. In some cases, you can identify forward-looking statements by terms such as "may," "should," "expects," "plans," "anticipates," "could," "intends," "target," "projects," "contemplates," "believes," "estimates," "predicts," "potential," or "continue," or the negative of these terms or other similar expressions. Aptorum Group has based these forward-looking statements, which include statements regarding projected timelines for application submissions and trials, largely on its current expectations and projections about future events and trends that it believes may affect its business, financial condition and results of operations. These forward-looking statements speak only as of the date of this press release and are subject to a number of risks, uncertainties and assumptions including, without limitation, risks related to its announced management and organizational changes, the continued service and availability of key personnel, its ability to expand its product assortments by offering additional products for additional consumer segments, development results, the company's anticipated growth strategies, anticipated trends and challenges in its business, and its expectations regarding, and the stability of, its supply chain, and the risks more fully described in Aptorum Group's Form 20-F and other filings that Aptorum Group may make with the SEC in the future. As a result, the projections included in such forward-looking statements are subject to change. Aptorum Group assumes no obligation to update any forward-looking statements contained in this press release as a result of new information, future events or otherwise.

1 mBio 2017 8(5): e01224-17
2 Microbiol Spectr. 2019 Mar;7(2)
3 Clin Infect Dis. 2019 Nov 27;69(12):2112-2118

Contacts
Investors:
Tel: +852 2117 6611
Email: investor.relations@aptorumgroup.com

Media:
Tel: + 852 2117 6611
Email: info@aptorumgroup.com


Copyright 2020 ACN Newswire. All rights reserved. http://www.acnnewswire.com